Primer AcanthF1

Target Group: 
Acanthomoeba
Target Region: 
?
Primer 5'-3': 
TTCCAGCTCCAATAGCGTAT
Sense 5'-3': 
Forward
Length: 
20
Tm (°C): 
49.7
%GC Content: 
45
Recipient: 
Aurélie Chambouvet
Remark: 
coupled with AcanthR1