Primer cox3F1Iso

Target Group: 
Noelaerhabdaceae
Target Region: 
cox3
Primer 5'-3': 
TCCTACACTTGGATATTTAG
Sense 5'-3': 
Forward
Length: 
20
Tm (°C): 
45.6
%GC Content: 
35
Recipient: 
Sarah Romac
Remark: 
coupled with cox3R3Iso(Isocox3a set) or cox3R6Iso (Isocox3b set)