Primer cox3R3Iso

Target Group: 
Noelaerhabdaceae
Target Region: 
cox3
Primer 5'-3': 
CCTTCTCTAGTAATGTCACGTC
Sense 5'-3': 
Reverse
Length: 
22
Tm (°C): 
53.0
%GC Content: 
45
Recipient: 
Sarah Romac