Primer HaptoR1

Target Group: 
Haptophyta
Target Region: 
18S
Primer 5'-3': 
CGAAACCAACAAAATAGCAC
Sense 5'-3': 
Reverse
Length: 
20
Tm (°C): 
47.7
%GC Content: 
40
Recipient: 
Elianne Egge