Primer HCO2198

Target Group: 
Amoebozoa
Target Region: 
LCO
Primer 5'-3': 
TAAACTTCAGGGTGACCAAAAAAT
Sense 5'-3': 
Reverse
Length: 
24
Tm (°C): 
50.6
%GC Content: 
33
Recipient: 
Alexander Kudryavtsev