Primer LAc_F

Target Group: 
Acantharea
Target Region: 
28S
Primer 5'-3': 
AAAAGTACGTGAAATCGTTAG
Sense 5'-3': 
Forward
Length: 
21
Tm (°C): 
46.5
%GC Content: 
33
Recipient: 
Sarah Romac
Remark: 
coupled with Lac_R