Primer LAc_R

Target Group: 
Acantharea
Target Region: 
28S
Primer 5'-3': 
TCACCATCTTTCGGGTCCCAACA
Sense 5'-3': 
Reverse
Length: 
23
Tm (°C): 
57.0
%GC Content: 
52
Recipient: 
Sarah Romac