Primer LCO1490

Target Group: 
Amoebozoa
Target Region: 
LCO
Primer 5'-3': 
GGTCAACAAATCATAAAGATATTGG
Sense 5'-3': 
Forward
Length: 
25
Tm (°C): 
51.1
%GC Content: 
32
Recipient: 
Alexander Kudryavtsev
Remark: 
coupled with HCO2198