Primer Leuk10R

Target Group: 
Haptophyta
Target Region: 
28S
Primer 5'-3': 
CAAAGTTCTTTGCATCTTTCC
Sense 5'-3': 
Reverse
Length: 
21
Tm (°C): 
48.5
%GC Content: 
38
Recipient: 
Lucie Bittner