Primer Leuk20r_high

Target Group: 
Haptophyta
Target Region: 
28S
Primer 5'-3': 
CTCCTTGGTCCGTGTTTCTAGACG
Sense 5'-3': 
Reverse
Length: 
24
Tm (°C): 
59.0
%GC Content: 
54
Recipient: 
Lucie Bittner
Remark: 
coupled with Lhapto4_high (LSU3 set)