Primer Lhapto20R_bis

Target Group: 
Haptophyta
Target Region: 
28S
Primer 5'-3': 
TCAGACTCCTTGGTCCGTGTTTCT
Sense 5'-3': 
Reverse
Length: 
24
Tm (°C): 
57.0
%GC Content: 
50
Recipient: 
Lucie Bittner