Primer Lhapto23R_high

Target Group: 
Haptophyta
Target Region: 
28S
Primer 5'-3': 
ATAGTTCACCATCTTTCGGGTCCCG
Sense 5'-3': 
Reverse
Length: 
25
Tm (°C): 
59.3
%GC Content: 
52
Recipient: 
Lucie Bittner