Primer Lhapto4_high

Target Group: 
Haptophyta
Target Region: 
28S
Primer 5'-3': 
TAATGGCGAATGAAGCGGGC
Sense 5'-3': 
Forward
Length: 
20
Tm (°C): 
53.8
%GC Content: 
55
Recipient: 
Lucie Bittner
Remark: 
coupled with Leuk10R (LSU4 set)