Primer LHapto8

Target Group: 
Haptophyta
Target Region: 
28S
Primer 5'-3': 
GGTATCGGAGAAGGTGAGAATCCT
Sense 5'-3': 
Forward
Length: 
24
Tm (°C): 
57.0
%GC Content: 
50
Recipient: 
Lucie Bittner
Remark: 
coupled with Lhapto20R_bis (LSU1 set)