Primer M4_18S-F

Target Group: 
MAST-4
Target Region: 
ITS1
Primer 5'-3': 
TGGGTAATCTTTGAACGTGAAT
Sense 5'-3': 
Forward
Length: 
22
Tm (°C): 
49.2
%GC Content: 
36
Recipient: 
Ramon Massana
Remark: 
coupled with M4_18S-F