Primer PLA491F

Target Group: 
Photosynthetic Euk
Target Region: 
ChlP_16Sa
Primer 5'-3': 
GAGGAATAAGCATCGGCTAA
Sense 5'-3': 
Forward
Length: 
20
Tm (°C): 
50.0
%GC Content: 
45
Recipient: 
Sarah Romac
Remark: 
coupled with PP936R