Primer NameTarget groupTarget RegionPrimer 5'-3'Sense 5'-3'LengthTm (°C)%GC ContentRecipientRemarkF16
X3NDf?18SGAGGGMAAGYCTGGTGCCAGCAGCCGForward2667.070David Basscoupled with 1256R
TAReuk_REukaryotes18S-V4ACTTTCGTTCTTGATYRAReverse1848.031Sarah Romac
TAReuk_F1Eukaryotes18S-V4CCAGCASCYGCGGTAATTCCForward2064.060Sarah Romaccoupled with TAReuk_R
S19FForaminifera18SGTACRAGGCATTCCTRGTTReverse2051.045Raphael Morard
S17Foraminifera18SCGGTCACGTTCGTTGCReverse1648.563Sarah Romac
S14F3Foraminifera18SACGCAMGTGTGAAACTTGForward1948.050Sarah Romaccoupled with S17
S14F1Foraminifera18SAAGGGCACCACAAGAACGCForward1953.058Raphael Morardcoupled with S19f
PRYM03+3Haptophyta18SGTAAATTGCCCGAATCCTGForward1948.947Elianne Eggecoupled with HaptoR1
PRYM01+7Haptophyta18SGATCAGTGAAAACATCCCTGGReverse2152.448Elianne Egge
preV4-noMIDEndomyxa18S-V4GYTGCAGTTAAAAAGCTCGTAGTTG2555.042David Basscoupled with 1256R
PP952FPhotosynthetic EukChlP_16SbGCACAAGCGGTGGAGYATGForward1955.055Sarah Romaccoupled with OXY1313R
PP936RPhotosynthetic EukChlP_16SaCCTTTGAGTTTCAYYCTTGCReverse2050.045Sarah Romac
PLA491FPhotosynthetic EukChlP_16SaGAGGAATAAGCATCGGCTAAForward2050.045Sarah Romaccoupled with PP936R
PELA03FPelagophyceaeITS1ATCACCTTGGTCGGCAGForward1749.559Ramon Massana
OXY1313RPhotosynthetic EukChlP_16SbCTTCAYGYAGGCGAGTTGCAGCReverse2260.055Sarah Romac
M4_5.8S_RMAST-4ITS1GTTGCGAGAACCTAGACReverse1747.153Ramon Massanacoupled with M4_18S-F
M4_18S-FMAST-4ITS1TGGGTAATCTTTGAACGTGAATForward2249.236Ramon Massanacoupled with M4_18S-F
Lhapto9_3Haptophyta28SCGGGYTGCTYGGGATTGCAGCTTGForward2461.058Lucie Bittnercoupled with Lhapto23R_high (LSU2 set)
LHapto8Haptophyta28SGGTATCGGAGAAGGTGAGAATCCTForward2457.050Lucie Bittnercoupled with Lhapto20R_bis (LSU1 set)
Lhapto4_highHaptophyta28STAATGGCGAATGAAGCGGGCForward2053.855Lucie Bittnercoupled with Leuk10R (LSU4 set)
Lhapto23R_highHaptophyta28SATAGTTCACCATCTTTCGGGTCCCGReverse2559.352Lucie Bittner
Lhapto20R_bisHaptophyta28STCAGACTCCTTGGTCCGTGTTTCTReverse2457.050Lucie Bittner
Leuk20r_highHaptophyta28SCTCCTTGGTCCGTGTTTCTAGACGReverse2459.054Lucie Bittnercoupled with Lhapto4_high (LSU3 set)
Leuk10RHaptophyta28SCAAAGTTCTTTGCATCTTTCCReverse2148.538Lucie Bittner
LCO1490AmoebozoaLCOGGTCAACAAATCATAAAGATATTGGForward2551.132Alexander Kudryavtsevcoupled with HCO2198
LAc_RAcantharea28STCACCATCTTTCGGGTCCCAACAReverse2357.052Sarah Romac
LAc_FAcantharea28SAAAAGTACGTGAAATCGTTAGForward2146.533Sarah Romaccoupled with Lac_R
HCO2198AmoebozoaLCOTAAACTTCAGGGTGACCAAAAAATReverse2450.633Alexander Kudryavtsev
HaptoR1Haptophyta18SCGAAACCAACAAAATAGCACReverse2047.740Elianne Egge
EndoR1Endomyxa18S-V4CGACTTCTCCTTCCTCTAARYRDTAWGReverse2757.543David Basscoupled with 1259-M19, 1259-W08,1259-T19,1259-C16,1259-G12,1259-C17, and 1259-W15
cox3R6IsoNoelaerhabdaceaecox3GTCAAATATTACGGATTTCReverse1942.532Sarah Romac
cox3R3IsoNoelaerhabdaceaecox3CCTTCTCTAGTAATGTCACGTCReverse2253.045Sarah Romac
cox3F1IsoNoelaerhabdaceaecox3TCCTACACTTGGATATTTAGForward2045.635Sarah Romaccoupled with cox3R3Iso(Isocox3a set) or cox3R6Iso (Isocox3b set)
Cil_FCiliates18S-V4TGGTAGTGTATTGGACWACCAForward2150.543Thorsten Stoeckcoupled with TAReuk_R
CHR03RChrysophyceae18STTAGCAGGCGGGGGTCTCReverse1854.967Ramon Massana
CHR02RChrysophyceae18SAATCATCTTCGATCCCCTReverse1845.844Ramon Massana
CHR01FChrysophyceae18SCAATAGCGTATACTAAAGForward1841.233Ramon Massanacoupled with CHR02R, or CHR03R
AcanthR1Acanthomoeba?TTCACGGTAWACGATCTGGReverse1948.049Aurélie Chambouvet
AcanthF1Acanthomoeba?TTCCAGCTCCAATAGCGTATForward2049.745Aurélie Chambouvetcoupled with AcanthR1
528FlongHaptophyta18SGCGGTAATTCCAGCTCCAAForward1951.153Elianne Eggecoupled with PRYM01+7
5.8SPelagophyceaeITS1CGCTGCGTTCTTCATCGReverse1749.559Ramon Massanacoupled with PELA03F
1510R (V9-Icomm)Eukaryotes18S-V9CCTTCYGCAGGTTCACCTACReverse2066.055Sarah Romac
1389F (V9-Icomm)Eukaryotes18S-V9TTGTACACACCGCCCForward1548.060Sarah Romaccoupled with 1510R (V9-Icomm)
1259-W15Endomyxa18S-V4AGGATTGACAGATTWAAGATCForward2146.533David Bass
1259-W08Endomyxa18S-V4AGGATTGWCAGATTGAAGATCForward2148.538David Bass
1259-T19Endomyxa18S-V4AGGATTGACAGRTTGAAGTTCForward2149.539David Bass
1259-M19Endomyxa18S-V4AGGATTGACAGATTGAAGMTCForward2149.539David Bass
1259-G12Endomyxa18S-V4AGGATTGACAGGTTGAAGAYCForward2151.545David Bass
1259-C17Endomyxa18S-V4AGGATTGACRGATTGACGATCForward2151.545David Bass
1259-C16Endomyxa18S-V4AGGATTGACAGATTKCAGATCForward2149.539David Bass
1256R?18SGCACCACCACCCAYAGAATCAAGAAAGAWCTTCReverse3364.047David Bass