Search Primers

Please contact Sarah Romac for further information. Click on the eppendorf for full details.

Primer Namesort ascending Target group Primer 5'-3' Sense 5'-3' Remark
X3NDf ? GAGGGMAAGYCTGGTGCCAGCAGCCG Forward coupled with 1256R
TAReuk_R Eukaryotes ACTTTCGTTCTTGATYRA Reverse
TAReuk_F1 Eukaryotes CCAGCASCYGCGGTAATTCC Forward coupled with TAReuk_R
S19F Foraminifera GTACRAGGCATTCCTRGTT Reverse
S17 Foraminifera CGGTCACGTTCGTTGC Reverse
S14F3 Foraminifera ACGCAMGTGTGAAACTTG Forward coupled with S17
S14F1 Foraminifera AAGGGCACCACAAGAACGC Forward coupled with S19f
PRYM03+3 Haptophyta GTAAATTGCCCGAATCCTG Forward coupled with HaptoR1
PRYM01+7 Haptophyta GATCAGTGAAAACATCCCTGG Reverse
preV4-noMID Endomyxa GYTGCAGTTAAAAAGCTCGTAGTTG coupled with 1256R
PP952F Photosynthetic Euk GCACAAGCGGTGGAGYATG Forward coupled with OXY1313R
PP936R Photosynthetic Euk CCTTTGAGTTTCAYYCTTGC Reverse
PLA491F Photosynthetic Euk GAGGAATAAGCATCGGCTAA Forward coupled with PP936R
PELA03F Pelagophyceae ATCACCTTGGTCGGCAG Forward
OXY1313R Photosynthetic Euk CTTCAYGYAGGCGAGTTGCAGC Reverse
M4_5.8S_R MAST-4 GTTGCGAGAACCTAGAC Reverse coupled with M4_18S-F
M4_18S-F MAST-4 TGGGTAATCTTTGAACGTGAAT Forward coupled with M4_18S-F
Lhapto9_3 Haptophyta CGGGYTGCTYGGGATTGCAGCTTG Forward coupled with Lhapto23R_high (LSU2 set)
LHapto8 Haptophyta GGTATCGGAGAAGGTGAGAATCCT Forward coupled with Lhapto20R_bis (LSU1 set)
Lhapto4_high Haptophyta TAATGGCGAATGAAGCGGGC Forward coupled with Leuk10R (LSU4 set)
Lhapto23R_high Haptophyta ATAGTTCACCATCTTTCGGGTCCCG Reverse
Lhapto20R_bis Haptophyta TCAGACTCCTTGGTCCGTGTTTCT Reverse
Leuk20r_high Haptophyta CTCCTTGGTCCGTGTTTCTAGACG Reverse coupled with Lhapto4_high (LSU3 set)
Leuk10R Haptophyta CAAAGTTCTTTGCATCTTTCC Reverse
LCO1490 Amoebozoa GGTCAACAAATCATAAAGATATTGG Forward coupled with HCO2198
LAc_R Acantharea TCACCATCTTTCGGGTCCCAACA Reverse
LAc_F Acantharea AAAAGTACGTGAAATCGTTAG Forward coupled with Lac_R
HCO2198 Amoebozoa TAAACTTCAGGGTGACCAAAAAAT Reverse
HaptoR1 Haptophyta CGAAACCAACAAAATAGCAC Reverse
EndoR1 Endomyxa CGACTTCTCCTTCCTCTAARYRDTAWG Reverse coupled with 1259-M19, 1259-W08,1259-T19,1259-C16,1259-G12,1259-C17, and 1259-W15
cox3R6Iso Noelaerhabdaceae GTCAAATATTACGGATTTC Reverse
cox3R3Iso Noelaerhabdaceae CCTTCTCTAGTAATGTCACGTC Reverse
cox3F1Iso Noelaerhabdaceae TCCTACACTTGGATATTTAG Forward coupled with cox3R3Iso(Isocox3a set) or cox3R6Iso (Isocox3b set)
Cil_F Ciliates TGGTAGTGTATTGGACWACCA Forward coupled with TAReuk_R
CHR03R Chrysophyceae TTAGCAGGCGGGGGTCTC Reverse
CHR02R Chrysophyceae AATCATCTTCGATCCCCT Reverse
CHR01F Chrysophyceae CAATAGCGTATACTAAAG Forward coupled with CHR02R, or CHR03R
AcanthR1 Acanthomoeba TTCACGGTAWACGATCTGG Reverse
AcanthF1 Acanthomoeba TTCCAGCTCCAATAGCGTAT Forward coupled with AcanthR1
528Flong Haptophyta GCGGTAATTCCAGCTCCAA Forward coupled with PRYM01+7
5.8S Pelagophyceae CGCTGCGTTCTTCATCG Reverse coupled with PELA03F
1510R (V9-Icomm) Eukaryotes CCTTCYGCAGGTTCACCTAC Reverse
1389F (V9-Icomm) Eukaryotes TTGTACACACCGCCC Forward coupled with 1510R (V9-Icomm)
1259-W15 Endomyxa AGGATTGACAGATTWAAGATC Forward
1259-W08 Endomyxa AGGATTGWCAGATTGAAGATC Forward
1259-T19 Endomyxa AGGATTGACAGRTTGAAGTTC Forward
1259-M19 Endomyxa AGGATTGACAGATTGAAGMTC Forward
1259-G12 Endomyxa AGGATTGACAGGTTGAAGAYC Forward
1259-C17 Endomyxa AGGATTGACRGATTGACGATC Forward
1259-C16 Endomyxa AGGATTGACAGATTKCAGATC Forward
1256R ? GCACCACCACCCAYAGAATCAAGAAAGAWCTTC Reverse
Export results to Excel