Primer PRYM01+7

Target Group: 
Haptophyta
Target Region: 
18S
Primer 5'-3': 
GATCAGTGAAAACATCCCTGG
Sense 5'-3': 
Reverse
Length: 
21
Tm (°C): 
52.4
%GC Content: 
48
Recipient: 
Elianne Egge